In order to enable the separate addition of a feasible volume of custom primers, some components were reformulated: FS1 of the basic kit contains an oligodT primer, FS1x from the module does not contain any primers. FS2 from the basic kit is added with 9.5 µl whereas only 4.5 µl of FS2x from the module are added per reaction allowing 5 µl of custom primers.

SS1 of the basic kit contains a random primer and 10 µl of SS1 are added per reaction, TS from the module does not contain any primers and only 7 µl are added per reaction leaving 2 µl available for the addition of custom primers.

The protocol is based on QuantSeq FWD (Cat. No. 015) strategy which gives all the functionalities needed for the custom library prep, therefore QuantSeq REV does not bring many advantages. Using QuantSeq REV protocol would yield sequences corresponding to cDNA. However, if you would like to have the custom protocol based on QuantSeq REV, please contact us for further recommendations.

First Strand Synthesis

Any primer used for First Strand cDNA Synthesis has to be designed with a partial Illumina P7 adapter extension. Adapter sequences are kept short pre-PCR in order to allow for efficient removal of short fragments during the purification step (steps 12 and 16). The full Illumina P7 (Read 2) adapter sequence will only be introduced during PCR (step 28).

Partial Illumina P7 Adapter Sequence (Read 2) for First Strand Synthesis Primer:

5’ GTTCAGACGTGTGCTCTTCCGATCT- Target sequence 3’

Here the target sequence has to be the reverse complement to the mRNA-sequence in question (=cDNA). The chosen target sequence should be as specific as possible with a Tm that is as close as possible to the intended reaction temperature (50 °C). In most cases 20 nts are enough. Target-specific primer sequences should not exceed a length of 50 nts. The entire primer including the Illumina Adapter sequence should not exceed 75 nts. The optimal primer length is 45 – 50 nts (25 nt Illumina Sequence + 20 – 25 nt targeted sequence).

We highly recommend checking your targeted primers using the NCBI Primer Blast tool available at https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome. Use the Primer Pair Specificity Check and run your primers against the RefSeq database (not just RefSeq mRNA). Primer specificity stringency settings can be adjusted regarding the allowed mis¬matches and positions of the mismatch within the primer.

Second Strand Synthesis

Any primer used for Second Strand cDNA Synthesis has to be designed with a partial Illumina P5 adapter extension. Adapter sequences are kept short pre-PCR in order to allow for efficient removal of short fragments during the purification step (steps 12 and 16).The full Illumina P5 (Read 1) adapter sequence will only be introduced during PCR (step 28).

Partial Illumina P5 Adapter Sequence (Read 1) for Second Strand Synthesis Primer:

5’ CACGACGCTCTTCCGATCT – Target sequence (mRNA-sequence) 3’

Here the target sequence has to be the mRNA-sequence in question. The chosen target sequence should be as specific as possible with a Tm that is as close as possible to the intended reaction temperature. In most cases 20 nts are enough. Target-specific primer sequences should not exceed a length of 50 nts. The entire primer including the Illumina Adapter sequence should not exceed 75 nt. The optimal primer length is 39 – 50 nt (19 nt Illumina Sequence + 20 – 31 nt targeted sequence). The Tm of the targeted primers should be within the range of the potential annealing temperature i.e., between 45 °C and 72 °C. Please note that temperatures below 45°C should not be used. Introduction of 1 – 3 phosphorothioate linkages (PTOs) at the 3’ end of the target-specific second strand synthesis primer may increase specificity.

Yes, a 6 – 8 nt long molecular index can be introduced between adapter sequence and target sequence. With molecular indices, PCR duplication events can be distinguished from unique priming events. Also by using this random sequence, cluster calling can be easily accomplished on Illumina platforms. Illumina platforms rely on the initial rounds of sequencing for cluster calling and an even nucleotide sequence (25 % of A, C, G, and T) is maintained at each of these positions. If these random nucleotides are not included, be sure to design and combine your targeted primers in such a way that the first 5 nts are equally balanced within the final lane mix.

Partial Illumina P7 Adapter Sequence (Read 2) for First Strand Synthesis Primer:

5’ GTTCAGACGTGTGCTCTTCCGATCT – NNNNNN(NN) – Target sequence (= cDNA sequence) 3’

If the molecular index is introduced in the First Strand Synthesis Primer a paired-end sequencing run is required for read-out.

Partial Illumina P5 Adapter Sequence (Read 1) for Second Strand Synthesis Primer:

5’ CACGACGCTCTTCCGATCT – NNNNNN(NN) – Target sequence (mRNA-sequence) 3’

You will get the full QuantSeq FWD kit (Cat. No. 015), which includes oligodT Primer for reverse transcription and a random primer for the second strand synthesis. The modules contain all the buffers and reagents to perform reactions using customer-supplied primers enabling full flexibility of the QuantSeq-Flex kit bundle. Additionally the QuantSeq-Flex First Strand Synthesis Module contains an oligodT primer, which can be added separately to as a control.

Yes, however the QuantSeq-Flex Modules are not stand-alone kits. They are Add-on Modules for the QuantSeq FWD kit (Cat. No. 015).
The QuantSeq-Flex First Strand Synthesis Module can be used with the second strand synthesis components included in the QuantSeq 015 kit. Also, the QuantSeq-Flex Second Strand Synthesis Module V2 can be used with the first strand synthesis components included in the QuantSeq 015 kit, depending what kind of libraries are to be generated.

No, it depends on what kind of targeted sequencing you intend to do. The modules are compatible with the QuantSeq FWD kit (Cat. No. 015). By getting only the QuantSeq-Flex First Strand Synthesis Module (Cat. No. 026) you can generate target-specifically primed libraries during reverse transcription and use the random primed second strand synthesis of QuantSeq 015 hence, generate targeted RNA-Seq libraries, allowing the identification of novel fusions.
By getting only the QuantSeq-Flex Second Strand Synthesis Module V2 (Cat. No. 028) you can generate oligodT primed libraries during reverse transcription (using the First Strand Synthesis of QuantSeq 015) and target-specifically primed libraries during second strand synthesis, which means targeted 3’ mRNA-Seq libraries. Please note that the second strand synthesis reaction requires annealing temperatures of >45 °C. In case you need lower temperatures contact info@lexogen.com.

Getting both the QuantSeq-Flex First and Second Strand Synthesis Module V2 allows you to generate targeted libraries in both reverse transcription and second strand synthesis (targeted RNA-Seq) to identify known targets.

Yes, blocking oligos can be added during second strand synthesis together with TS buffer. We recommend a final concentration of 10 -100 nM of the blocking oligos during the second strand synthesis. Ideally those blocking oligos should bind close to the 3’ end on the transcript that should be blocked, this way exponential amplification of those highly abundant transcripts during the PCR is rendered impossible.

First Strand Synthesis
The concentration of a target-specific reverse transcription primer should be around 12.5 nM – 1.25 µM final concentration (in this case it would mean you would need 5 µl of a 50 nM – 5 µM target-specific primer). The total concentration of oligos in the first strand synthesis reaction should not exceed 2 µM. The higher the primer concentration the higher the likelihood of unspecific binding. However, the exact primer concentration and reaction temperature (up to 50 °C for first strand synthesis and second strand synthesis) strongly depends on the custom primer(s) used and has to be optimized accordingly.

Second Strand Synthesis
The concentration of a target-specific second strand synthesis primer should be 0.5 µM final concentration of the target primer (i.e., 2 µl of 7.5 pM Custom Target Primer). The total concentration of all oligos in the second strand synthesis reaction should not exceed 2 µM. The higher the primer concentration the higher the likelihood of unspecific binding. The annealing temperature should be chose according to the Tm of the targeted primers and can range from 45 °C to 72 °C. The extension temperature should be 72 °C.

For determination of the optimal number of PCR cycles we strongly recommend taking advantage of the qPCR assay as described in the QuantSeq-Flex User Guide, Appendix F, p.31. The required cycle number depends on multiple factors such as the number of targeted transcripts, their abundance, the primers and the primer concentration used, the RNA input and hence needs to be determined by qPCR first. Lexogen offers a PCR Add-on Kit for Illumina (Cat. No. 020.96) for this purpose.

• First Strand cDNA Synthesis (p.13-14): Do not cool the mastermix containing E1 (step 3) and have the RNA/Custom Targeted Primer or RNA/FS1/dT samples at 42-50 °C when adding the E1-containing mastermix (step 4) to avoid mishybridization. Mix properly by pipetting. Do not forget to shortly spin down the samples at room temperature before and after adding the E1-containing mastermix.

• Use higher input amounts of RNA where possible.
• Use 1 hour incubation time for reverse transcription (step 4).
• Use 48ul of PS at step 16.
• We recommend performing a qPCR assay to determine the optimal cycle number for library amplification. The PCR add-on kit for Illumina (Cat. No. 020.96) provides reagents for performing these assays. In addition SYBR Green I (Sigma-Aldrich, Cat. No. S9430; 10,000x in DMSO) is needed for the qPCR assay.

Yes, the i5 Dual Indexing Add-on Kits can be used for dual indexing of QuantSeq-Flex libraries. Alternatively, up to 384 pre-mixed UDIs of the Lexogen UDI 12 nt Unique Dual Indexing Add-on Kits (Cat. No. 107-111.96 and 120.384) can be used to replace the i7 6 nt indices provided in the QuantSeq REV kits.

When designing targeted primers for QuantSeq-Flex, the partial P5 and P7 adapter sequences as indicated in the QuantSeq-Flex User Guide (015UG058, see Appendix D) need to be included to enable library amplification using the i5 and i7 index primers. Please refer to the i5 6 nt Dual Indexing Add-on Kits Instruction Manual (047IM109) or the Lexogen 12 nt Unique Dual Indexing Add-on Kit Instruction Manual (107IM223) for details of dual-indexed library amplification and purification.

For further information about the Dual Indexing Add-on Kits please see the online frequently asked questions on the QuantSeq FWD product page.

We do not recommend multiplexing Lexogen libraries with libraries from other vendors in the same sequencing lane. Though this is possible in principle, specific optimization of index combinations, library pooling conditions, and loading amounts may be required, even for advanced users. Sequencing complex pools that include different library types at different lane shares may have unpredictable effects on sequencing run metrics, read quality, read outputs, and/or demultiplexing performance. Lexogen assumes no responsibility for the altered performance of Lexogen libraries sequenced in combination with external library types in the same lane (or run).

Due to size differences, libraries prepared with the Lexogen Small RNA-Seq Library Prep Kit (or any other small RNA library prep kit) should not be sequenced together with QuantSeq or SENSE libraries. Please refer to the sequencing guidelines for each library type (library adapter details, loading amounts to use, and use of custom sequencing primers, etc), which are provided in our Library Prep Kit User Guides, and online Frequently Asked Questions (FAQs).