Description

QuantSeq-Flex Targeted RNA-Seq Library Prep Kit V2 for Illumina

The QuantSeq-Flex Kit is a library preparation protocol designed to make Illumina compatible libraries from any RNA sample using custom primers. It is open for development by advanced RNA-Seq users based on their custom needs.

The kit is based on the QuantSeq FWD Kit for Illumina (Cat. No. 015) strategy, with compatible reagents and Read 1 linker sequence introduced by the second strand synthesis primer. Hence the reads generated during the NGS run directly correspond to the RNA sequence.

QuantSeq-Flex Kit provides modules for Reverse Transcription (RT) and SSS, allowing users to choose their own primers for either one of these steps or both of them. This offers maximum flexibility in the choice of targets and input material.

With this highly flexible QuantSeq kit the following types of libraries can be generated:
1.) OligodT primed in reverse transcription, random primed in second strand synthesis (QuantSeq 3’ mRNA-Seq)
2.) OligodT primed in reverse transcription, target-specifically primed in second strand synthesis (targeted 3’ mRNA-Seq)
3.) Target-specifically primed in reverse transcription, random primed in second strand synthesis (targeted RNA-Seq, allows for identification of novel fusions)
4.) Target-specifically primed in reverse transcription, target-specifically primed in second strand synthesis (targeted RNA-Seq, known targets detectable only)

Whether it is gene expression analysis, targeted sequencing, adapter ligation-based RNA-Seq or any other experiment where a certain RNA region needs to be sequenced, QuantSeq-Flex can be used together with user-supplied primers.

Perfect for Gene Counting

Just one fragment per transcript is produced; therefore no length normalization is required. This allows more accurate determination of gene expression values and makes QuantSeq the best alternative to microarrays and conventional RNA-Seq in gene expression and eQTL studies.

Cost Saving Multiplexing

QuantSeq libraries are intended for a high degree of multiplexing. Up to 384 samples can be multiplexed/lane on an Illumina flow cell using the up to 96 i7 indices included in the kit together with the four i5 indices as part of the i5 Dual Indexing Add-on Kit (Cat. No. 047).This high level of multiplexing allows saving costs as the length restriction in QuantSeq saves sequencing space.

In order to be compatible with the supplied indices (barcode primers) please note our recommendations for the custom primer design (see Appendix D: Primer Design, QuantSeq-Flex User Guide, p.25)

Rapid Turnaround

Simple workflow allows generating libraries ready for sequencing within 4.5 hours. This already includes hands-on time, which is less than 2 hours.

An RNA-Seq Experiment Tailored to Your Needs

QuantSeq-Flex modular kit gives maximum flexibility to the user encouraging implementation of RNA-Seq as a part of the experimental pipeline. One fragment per transcript produced and usage of custom primers makes this kit a perfect solution for cost-saving high-throughput gene expression analysis. QuantSeq-Flex is suitable for targeted sequencing of gene panels, enrichment, detection of fusion genes, and various other types of transcripts.

Workflow

QuantSeq-Flex has a short and simple workflow and can be completed within 4.5 hours. The required hands-on time is less than 2 hours. The kit uses total RNA as input, hence no prior poly(A) enrichment or rRNA depletion is needed. Although if using random priming for RT a depletion may be advisable.

Reverse Transcription
Step 1:
The kit uses total RNA as input, hence no prior poly(A) enrichment
or rRNA depletion is needed.
Reverse Transcription
Step 1:
Library generation starts either with oligodT (included in the kit) or
a target-specific primer containing sequencing platform - compatible
linker sequences.
Removal of RNA
Step 2:
After first strand synthesis the RNA is removed.
Second-Strand Synthesis
Step 3:
Second strand synthesis is initiated by random (included in the kit) or
target-specific priming and a DNA polymerase. The primers also
contain sequencing platform - compatible linker sequences.
Second-Strand Synthesis
Step 3:
No purification is required between first and second strand synthesis.
Second strand synthesis is followed by a magnetic bead-based
purification step rendering the protocol compatible with automation.
Library Amplification
Step 4:
During the library amplification step sequences required
for cluster generation are introduced.
Library Amplification
Step 4:
Multiplexing can be performed with up to 384 barcode combinations
using the up to 96 available i7 indices included in the kit and four
additionally available i5 indices from the i5 Dual Indexing Add-on Kit
(Cat. No. 047).

For viewing the whole workflow on page please click here

Multiplexing

QuantSeq libraries are intended for a high degree of multiplexing. The kit already includes up to 96 i7 primer (7001-7096) which are introduced as standard external barcodes during the PCR amplification. For dual indexing allowing multiplexing of up to 384 libraries, an i5 Dual Indexing Add-on Kit (Cat. No. 047) with four additional i5 indices (5001-5004) is available.

i7 Index Plate (7001-7096)

1 2 3 4 5 6 7 8 9 10 11 12
A 7001:
CAGCGT
7009:
TCAGGA
7017:
TCTTAA
7025:
TTTATG
7033:
AGATAG
7041:
CTCTCG
7049:
GTGCCA
7057:
AGTACT
7065:
AAGCTC
7073:
GACATC
7081:
GCAGCC
7089:
CGCGGA
B 7002:
GATCAC
7010:
CGGTTA
7018:
GTCAGG
7026:
AACGCC
7034:
TTGGTA
7042:
TGACAC
7050:
TCGAGG
7058:
ATAAGA
7066:
GACGAT
7074:
CGATCT
7082:
ACTCTT
7090:
CCTGCT
C 7003:
ACCAGT
7011:
TTAACT
7019:
ATACTG
7027:
CAAGCA
7035:
GTTACC
7043:
AAGACA
7051:
CACTAA
7059:
GGTGAG
7067:
TCGTTC
7075:
CGTCGC
7083:
TGCTAT
7091:
GCGCTG
D 7004:
TGCACG
7012:
ATGAAC
7020:
TATGTC
7028:
GCTCGA
7036:
CGCAAC
7044:
ACAGAT
7052:
GGTATA
7060:
TTCCGC
7068:
CCAATT
7076:
ATGGCG
7084:
AAGTGG
7092:
GAACCT
E 7005:
ACATTA
7013:
CCTAAG
7021:
GAGTCC
7029:
GCGAAT
7037:
TGGCGA
7045:
TAGGCT
7053:
CGCCTG
7061:
GAAGTG
7069:
AGTTGA
7077:
ATTGGT
7085:
CTCATA
7093:
TTCGAG
F 7006:
GTGTAG
7014:
AATCCG
7022:
GGAGGT
7030:
TGGATT
7038:
ACCGTG
7046:
CTCCAT
7054:
AATGAA
7062:
CAATGC
7070:
AACCGA
7078:
GCCACA
7086:
CCGACC
7094:
AGAATC
G 7007:
CTAGTC
7015:
GGCTGC
7023:
CACACT
7031:
ACCTAC
7039:
CAACAG
7047:
GCATGG
7055:
ACAACG
7063:
ACGTCT
7071:
CAGATG
7079:
CATCTA
7087:
GGCCAA
7095:
AGGCAT
H 7008:
TGTGCA
7016:
TACCTT
7024:
CCGCAA
7032:
CGAAGG
7040:
GATTGT
7048:
AATAGC
7056:
ATATCC
7064:
CAGGAC
7072:
GTAGAA
7080:
AACAAG
7088:
AGACCA
7096:
ACACGC

i5 Index Primers (Cat. No. 047)

5001 CGCCAT
5002 ATTTTA
5003 GCAACG
5004 TAGGGC

FAQ

Frequently Asked Questions

Please find a list of the most frequently asked questions below. If you cannot find the answer to your question here or want to know more about our products, please contact support@lexogen.com.

Open All

In order to enable the separate addition of a feasible volume of custom primers, some components were reformulated: FS1 of the basic kit contains an oligodT primer, FS1x from the module does not contain any primers. FS2 from the basic kit is added with 9.5 µl whereas only 4.5 µl of FS2x from the module are added per reaction allowing 5 µl of custom primers.

SS1 of the basic kit contains a random primer and 10 µl of SS1 are added per reaction, TS from the module does not contain any primers and only 7 µl are added per reaction leaving 2 µl available for the addition of custom primers.

The protocol is based on QuantSeq FWD (Cat. No. 015) strategy which gives all the functionalities needed for the custom library prep, therefore QuantSeq REV does not bring many advantages. Using QuantSeq REV protocol would yield sequences corresponding to cDNA. However, if you would like to have the custom protocol based on QuantSeq REV, please contact us for further recommendations.

First Strand Synthesis

Any primer used for First Strand cDNA Synthesis has to be designed with a partial Illumina P7 adapter extension. Adapter sequences are kept short pre-PCR in order to allow for efficient removal of short fragments during the purification step (steps 12 and 16). The full Illumina P7 (Read 2) adapter sequence will only be introduced during PCR (step 28).

Partial Illumina P7 Adapter Sequence (Read 2) for First Strand Synthesis Primer:

5’ GTTCAGACGTGTGCTCTTCCGATCT- Target sequence 3’

Here the target sequence has to be the reverse complement to the mRNA-sequence in question (=cDNA). The chosen target sequence should be as specific as possible with a Tm that is as close as possible to the intended reaction temperature (50 °C). In most cases 20 nts are enough. Target-specific primer sequences should not exceed a length of 50 nts. The entire primer including the Illumina Adapter sequence should not excced 75 nts. The optimal primer length is 45 – 50 nts (25 nt Illumina Sequence + 20 – 25 nt targeted sequence).

We highly recommend checking your targeted primers using the NCBI Primer Blast tool available at https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome. Use the Primer Pair Specificity Check and run your primers against the RefSeq database (not just RefSeq mRNA). Primer specificity stringency settings can be adjusted regarding the allowed mis¬matches and positions of the mismatch within the primer.

Second Strand Synthesis

Any primer used for Second Strand cDNA Synthesis has to be designed with a partial Illumina P5 adapter extension. Adapter sequences are kept short pre-PCR in order to allow for efficient removal of short fragments during the purification step (steps 12 and 16).The full Illumina P5 (Read 1) adapter sequence will only be introduced during PCR (step 28).

Partial Illumina P5 Adapter Sequence (Read 1) for Second Strand Synthesis Primer:

5’ CACGACGCTCTTCCGATCT – Target sequence (mRNA-sequence) 3’

Here the target sequence has to be the mRNA-sequence in question. The chosen target sequence should be as specific as possible with a Tm that is as close as possible to the intended reaction temperature. In most cases 20 nts are enough. Target-specific primer sequences should not exceed a length of 50 nts. The entire primer including the Illumina Adapter sequence should not exceed 75 nt. The optimal primer length is 39 – 50 nt (19 nt Illumina Sequence + 20 – 31 nt targeted sequence). The Tm of the targeted primers should be within the range oft he potential annealing temperature i.e., between 45 °C and 72 °C. Please note that temperatures below 45°C should not be used. Introduction of 1 – 3 phosphorothioate linkages (PTOs) at the 3’ end of the target-specific second strand synthesis primer may increase specificity.

Yes, a 6 – 8 nt long molecular index can be introduced between adapter sequence and target sequence. With molecular indices, PCR duplication events can be distinguished from unique priming events. Also by using this random sequence, cluster calling can be easily accomplished on Illumina platforms. Illumina platforms rely on the initial rounds of sequencing for cluster calling and an even nucleotide sequence (25 % of A, C, G, and T) is maintained at each of these positions. If these random nucleotides are not included, be sure to design and combine your targeted primers in such a way that the first 5 nts are equally balanced within the final lane mix.

Partial Illumina P7 Adapter Sequence (Read 2) for First Strand Synthesis Primer:

5’ GTTCAGACGTGTGCTCTTCCGATCT – NNNNNN(NN) – Target sequence (= cDNA sequence) 3’

If the molecular index is introduced in the First Strand Synthesis Primer a paired-end sequencing run is required for read-out.

Partial Illumina P5 Adapter Sequence (Read 1) for Second Strand Synthesis Primer:

5’ CACGACGCTCTTCCGATCT – NNNNNN(NN) – Target sequence (mRNA-sequence) 3’

You will get the full QuantSeq FWD kit (Cat. No. 015), which includes oligodT Primer for reverse transcription and a random primer for the second strand synthesis. The modules contain all the buffers and reagents to perform reactions using customer-supplied primers enabling full flexibility of the QuantSeq-Flex kit bundle. Additionally the QuantSeq-Flex First Strand Synthesis Module contains an oligodT primer, which can be added separately to as a control.
Yes, however the QuantSeq-Flex Modules are not stand-alone kits. They are Add-on Modules for the QuantSeq FWD kit (Cat. No. 015).
The QuantSeq-Flex First Strand Synthesis Module can be used with the second strand synthesis components included in the QuantSeq 015 kit. Also, the QuantSeq-Flex Second Strand Synthesis Module V2 can be used with the first strand synthesis components included in the QuantSeq 015 kit, depending what kind of libraries are to be generated.
No, it depends on what kind of targeted sequencing you intend to do. The modules are compatible with the QuantSeq FWD kit (Cat. No. 015). By getting only the QuantSeq-Flex First Strand Synthesis Module (Cat. No. 026) you can generate target-specifically primed libraries during reverse transcription and use the random primed second strand synthesis of QuantSeq 015 hence, generate targeted RNA-Seq libraries, allowing the identification of novel fusions.
By getting only the QuantSeq-Flex Second Strand Synthesis Module V2 (Cat. No. 028) you can generate oligodT primed libraries during reverse transcription (using the First Strand Synthesis of QuantSeq 015) and target-specifically primed libraries during second strand synthesis, which means targeted 3’ mRNA-Seq libraries. Please note that the second strand synthesis reaction requires annealing temperatures of >45 °C. In case you need lower temperatures contact info@lexogen.com.

Getting both the QuantSeq-Flex First and Second Strand Synthesis Module V2 allows you to generate targeted libraries in both reverse transcription and second strand synthesis (targeted RNA-Seq) to identify known targets.

Yes, blocking oligos can be added during second strand synthesis together with TS buffer. We recommend a final concentration of 10 -100 nM of the blocking oligos during the second strand synthesis. Ideally those blocking oligos should bind close to the 3’ end on the transcript that should be blocked, this way exponential amplification of those highly abundant transcripts during the PCR is rendered impossible.
First Strand Synthesis
The concentration of a target-specific reverse transcription primer should be around 12.5 nM – 1.25 µM final concentration (in this case it would mean you would need 5 µl of a 50 nM – 5 µM target-specific primer). The total concentration of oligos in the first strand synthesis reaction should not exceed 2 µM. The higher the primer concentration the higher the likelihood of unspecific binding. However, the exact primer concentration and reaction temperature (up to 50 °C for first strand synthesis and second strand synthesis) strongly depends on the custom primer(s) used and has to be optimized accordingly.

Second Strand Synthesis
The concentration of a target-specific second strand synthesis primer should be 0.5 µM final concentration of the target primer (i.e., 2 µl of 7.5 pM Custom Target Primer). The total concentration of all oligos in the second strand synthesis reaction should not exceed 2 µM. The higher the primer concentration the higher the likelihood of unspecific binding. The annealing temperature should be chose according to the Tm of the targeted primers and can range from 45 °C to 72 °C. The extension temperature should be 72 °C.

For determination of the optimal number of PCR cycles we strongly recommend taking advantage of the qPCR assay as described in the QuantSeq-Flex User Guide, Appendix F, p.28. The required cycle number depends on multiple factors such as the number of targeted transcripts, their abundance, the primers and the primer concentration used, the RNA input and hence needs to be determined by qPCR first. Lexogen offers a PCR Add-on Kit for Illumina (Cat. No. 020.96) for this purpose.
With the upgrade to the QuantSeq-Flex Targeted RNA-Seq Library Prep Kit V2 a completely new and streamlined protocol is introduced for the target-specific second strand synthesis. By the use of a different polymerase compared to the standard kit, higher temperatures for the target-specific primer annealing are possible, resulting in a higher sensitivity. This requires to use annealing temperatures of the target-specific primers of >45 °C. In case you need lower temperatures, please contact info@lexogen.com. Besides, no RNA removal is necessary which also shortens the protocol.

Downloads

QuantSeq-Flex Targeted RNA-Seq Library Prep Kit V2 for Illumina platforms

pdf  User Guide – update 17.02.2017 (QuantSeq-Flex V2 User Guide is now compatible with the upgraded QuantSeq protocol; option to use dual indexing; rearrangement of the i7 barcodes for an improved balance)

pdf
PCR Add-on Kit for Illumina Instruction Manual – update 17.02.2017 (compatible with the QuantSeq upgrade, BC00 was renamed to P7 Primer 7000)
pdf i5 Dual Indexing Add-on Kit for QuantSeq/SENSE Instruction Manual– update 17.02.2016 (protocol adjusted to the upgraded QuantSeq protocol)

pdf
  QuantSeq for Illumina Index Primer (i7 Index Plate) – for kits bought after 17.02.2017
pdf Barcode Plate Overview – for kits bought before 17.02.2017

autoQuantSeq 3′ mRNA-Seq Library Prep Kit for Illumina

Agilent Bravo – Please inquire at info@lexogen.com for the automation scripts

Material Safety Datasheets

pdf  MSDS information for QuantSeq Expression Profiling Library Prep Kits – updated 17.02.2017 (to be compatible with QuantSeq upgrade)

Want to try QuantSeq-Flex Targeted RNA-Seq V2 on your samples?

Buy from our webstore

Dear Customer,

If you are interested in discussing your QuantSeq Flex project with Lexogen scientist, please contact us at info@lexogen.com.