The Small RNA-Seq kit can be used for inputs from 100 ng – 1,000 ng of cellular total RNA or 50 pg – 1,000 ng enriched small RNA including low RNA content samples such as plasma, serum, and urine.
In general, we would recommend using 100 ng of total RNA input from cells or tissues. For 100 ng input amounts we recommend using 0.5x dilution of 3’ Adapter, 5’ Adapter, and RT-Primer and 50 µl of EtOH.

RNA input amounts lower than 100 ng (for total RNA or enriched small RNA) require protocol adjustments. These include dilution of the 3’ Adapter, 5’ Adapter, and RT-Primer and adjusted endpoint PCR cycle numbers (see Appendix B, p.20 of the User Guide). Total RNA input amounts less than 100 ng could also be used. The minimum amount of total RNA input depends on the small RNA content of the sample in question. For samples with a small RNA content of 10 %, 1 ng total RNA may be used as minimal amount. Increase the input material for total RNA samples with less small RNA.

We highly recommend using Lexogen’s SPLIT RNA Extraction Kit (Cat. No. 008, Protocol for Small RNA Fraction or Total RNA Isolation), which enables the direct extraction of small RNA (down to 17 nt). When isolating total RNA for input, ensure that the protocol can recover small RNA (including miRNA). Many commercial products are using silica-based purification technology that may exclude small RNA. Please consult the manufacturer’s specifications. For bodily fluid, such as plasma, serum, urine or exosomes, isolation of total RNA is preferred. There is no need to fractionate for small RNA.

In general, we recommend processing a minimum of 8 samples, using a complete set of eight Small RNA i7 Indices for multiplexing (e.g., SRi7001-7008). However, if fewer barcodes are required care should be taken to always use indices which give a well-balanced signal in both lasers (red and green channels) for each nucleotide position. All columns (1-12) and rows (A-H) fulfill these criteria. The individual libraries within a lane should be mixed at an equimolar ratio to ensure this balance. An evaluation tool to check the color balance of index subsets is available under Support Tools. Please contact info@lexogen.com if you are interested in dual indexing options for Small RNA-Seq Libraries.

The Small RNA-Seq Library Prep Kit is appropriate for sequencing on Illumina platforms (HiSeq2000, HiSeq3000, HiSeq4000, NextSeq 500, NextSeq 550, MiSeq, MiniSeq, GAIIX). The libraries are compatible with standard Illumina sequencing primers and no custom sequencing primers are required.
Current loading amount recommendations are available for the following instruments:

• MiSeq / HiSeq2500 / HiSeq4000: 15 – 20 pM
• NextSeq 500 / 550: 1.8 – 2.5 pM

For Small RNA-Seq libraries in general short read lengths (e.g., SR50) are sufficient. The libraries are compatible with single-read (SR) and paired-end (PE) sequencing reagents. Small RNAs are RNAs ≤200 nt in length, and include microRNA (miRNA), Piwi-interacting RNA (piRNA), small interfering RNA (siRNA), small nucleolar RNA (snoRNAs), tRNA-derived small RNA (tsRNA), small rDNA-derived RNA (srRNA), and small nuclear RNA, also commonly referred to as U-RNA.

For total RNA and sometimes for enriched small RNA inputs the final library will contain library inserts that are longer than the miRNA fraction. The adapters will also ligate to other RNA types present in total RNA (e.g., tRNAs, piRNAs, mRNAs, snRNA, and ribosomal RNA), hence long library fragments (200 – 1,000 bp) should be removed to focus the sequencing depth on the miRNA fraction. In addition, small RNA-Seq library preps from limited amounts of starting material may contain linker-linker artifacts (at 120 bp). We recommend the use of Lexogen’s Purification Module with Magnetic Beads (Cat. No. 022) for this size selection. A bundled version of the Small RNA-Seq Library Prep Kit including Purification Module with Magnetic Beads (Cat. No. 058) is also available from Lexogen.
Protocol guidelines for bead-based purification of Small RNA-Seq libraries can be found in Appendix G (p.25) of the Small RNA-Seq Library Prep Kit User Guide.

A general recommendation would be to have at least 1-2 million mapped reads per sample for gene expression analyses, and at least 10 million reads per sample for small RNA discovery.
Depending on the starting sample and the application, aiming for a minimum of 4-5 million raw reads per sample would be recommended. For low input RNA amounts or libraries with lower small RNA content, higher numbers of reads per sample may be required.

Depending on the focus of the experiment there are different potential ways in which to analyze small RNA-Seq data.
An example workflow for analysis of miRNAs in small RNA-Seq library sequencing data is provided. This workflow was adapted from: Tam et al., (2015) Optimization of miRNA-seq data preprocessing. Briefings in Bioinformatics 16(6). This paper also provides an additional comparison of programs for read mapping (alignment), normalization methods, and differential expression analysis.

The general workflow involves, trimming of adapters, size filtering of trimmed reads, read mapping:

1. Trimming, adapter-removal, and size filtering (BBDuk, http://jgi.doe.gov/data-and-tools/bbtools/bb-tools-user-guide/bbduk-guide/)
1.1. Use bbduk.sh to remove the adapter sequence from the 3’ end of the reads and trim homopolymers.
1.2. Split up the reads into short read and long read fractions.
1.2.1. Short reads read into the adapter sequence AND are shorter than 31 bp and are processed for miRNA alignment.
1.2.2. Long reads are kept separate for alignment to the reference genome.
2. Mapping* (BWA, http://bio-bwa.sourceforge.net/, BBMap, https://sourceforge.net/projects/bbmap/)
2.1. Short read fraction
2.1.1. Filter out reads <= 14 bp -> outputs: “filtered reads: too short” statistic
2.1.2. Map the remaining 15 – 31 bp reads to the ribosomal RNA sequences using BWA. -> outputs: “mapped reads” and “unmapped reads”, mapping statistics
2.1.3. Use the unmapped reads from the BWA alignment and map these against the mirBase annotation (http://www.mirbase.org/ftp.shtml; mature miRNAs, species-specific) -> output “mapped reads”, read count statistics, and miRNA-count table.
2.2. Long read fraction
2.2.1. Map long reads against the reference genome using STAR (https://github.com/alexdobin/STAR) -> output: “mapped reads”, read count statistics, gene_biotype statistics (including rRNA sequences), and gene-read table.
* Alternative programs for read mapping can also be used. A comparison of alignment programs for small RNA-Seq data can be found in Tam et al., 2015.

5’- TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC – 3’

Cycle numbers for the endpoint PCR are indicated in the table in Appendix B (p.20) of the Small RNA-Seq Library Prep Kit User Guide. For example, we recommend ideally using an input amount of 100 ng and using 15 cycles for endpoint PCR. If starting with 1,000 ng input RNA then 12 cycles can be used. Depending on the small RNA content of the initial RNA sample an additional 1 or 2 cycles could be added.

For gel purification of Small RNA-Seq libraries, we recommend performing the size selection on the lane mix using 3 % agarose gels stained with EtBr. Prepare an equimolar lane mix (calculated from the Bioanalyzer in the range from 135 – 150 bp, i.e., the miRNA fraction), load the lane mix, and run the agarose + EtBr gel in TBE for 2 hours at 80 V. Excise the desired band(s) and avoid recovering the ~120 bp linker-linker artifacts that contain no insert. For final gel extraction, any commercially available gel extraction kit can be used.

It is not necessary to perform ribosomal RNA (rRNA) depletion for the small RNA-Seq Library prep, as the protocol has been designed for, and works ideally with total RNA as input.
Additional magnetic bead-based size selection can also be used to remove longer library products after the library prep has been completed.
It is not recommended to use RiboCop for rRNA depletion if you intend to use the RNA for downstream small RNA-Seq library prep. This is because the small RNA fraction can be reduced during the purification steps of the RiboCop protocol.

At present there are no Unique Molecular Identifiers included in the adapters used for the Small RNA-Seq library preps.

We do not recommend multiplexing Lexogen libraries with libraries from other vendors in the same sequencing lane. Though this is possible in principle, specific optimization of index combinations, library pooling conditions, and loading amounts may be required, even for advanced users. Sequencing complex pools that include different library types at different lane shares may have unpredictable effects on sequencing run metrics, read quality, read outputs, and/or demultiplexing performance. Lexogen assumes no responsibility for the altered performance of Lexogen libraries sequenced in combination with external library types in the same lane (or run).

Due to size differences, libraries prepared with the Lexogen Small RNA-Seq Library Prep Kit (or any other small RNA library prep kit) should not be sequenced together with QuantSeq or SENSE libraries. Please refer to the sequencing guidelines for each library type (library adapter details, loading amounts to use, and use of custom sequencing primers, etc), which are provided in our Library Prep Kit User Guides, and online Frequently Asked Questions (FAQs).