The full-length cDNA synthesis takes around 5 hours in total, including just 60 minutes of hands-on time. Endpoint PCR for amplification of TeloPrime cDNA using the V2 kits takes between 5 – 8 hours (or depending on the number of PCR cycles) with only 25 minutes are hands-on time. The qPCR, which is strongly recommended, is performed prior to endpoint PCR, takes ~14 hours, and is best run overnight.

Tagging on the 5’ end is based on Lexogen´s proprietary Cap Dependent Linker Ligation (CDLL) technology. After reverse transcription and the creation of a double-stranded RNA : cDNA hybrid, an adapter with a 5’ C overhang facilitates atypical base-pairing with the inverted G of the cap structure. Ligation takes place using a double-strand specific ligase, by ligating the 3’ end of the double-stranded Cap linker to the 3’ end of the cDNA.
Tagging of the 3’ end of the mRNA takes place during the reverse transcription through the use of oligodT priming.

The TeloPrime protocol has been validated with input amounts of 1 ng to 2 µg of total RNA input using Universal Human Reference RNA (Agilent Technologies), as well as RNA extracted from mouse liver, kidney, brain, lung, spleen, thymus, and heart, and Human Brain Reference RNA. We recommend using the highest quality total RNA as input to maximise the yield and length of the amplified cDNA.

For long-read sequencing applications we recommend using higher input amounts of 1 – 2 µg of total RNA. See also Appendix A (p.20) of the TeloPrime V2 User Guide for more details.

We recommend using the highest quality RNA available as input for TeloPrime cDNA generation. Lower quality RNA (RIN <8) can also be used as input. However, as RNA integrity decreases the proportion of transcripts with an intact 5’ cap is reduced. TeloPrime can still generate full-length cDNA from remaining intact capped and polyadenylated mRNAs present in low quality total RNA samples, though the maximum length of the amplified cDNA may be reduced compared to cDNA prepared from higher quality inputs. When using lower quality RNA as input, the Optimal Endpoint PCR cycle number (OEP) should be determined using the qPCR assay (see FAQ 7 below, and Appendix B (p.22) of the TeloPrime V2 User Guide).

The TeloPrime V2 PCR protocol has been validated with various RNA sources, including plants (Figure 1), and different vertebrate species, including sheep (Figure 2), and Universal Human Reference RNA (UHRR, Figure 3). The length distribution of the cDNA may vary according to the input RNA type. Note that the samples in Figures 1-3 have been run using different types of Bioanalyzer 2100 DNA Chip Assays.
Figure 1 | TeloPrime cDNA prepared with V2 PCR Protocol for vertebrate and plant RNA. TeloPrime cDNA was generated from 1 µg of total RNA using a custom reverse transcription primer. The cDNA was amplified using a custom PCR reverse primer and the standard Forward PCR primer (FP), with 17 cycles (vertebrate, red trace) or 21 cycles (plant 1, blue trace, and plant 2, green trace) for endpoint PCR. PCR products were purified using 1x AMPure® PB beads (Pacific Biosciences) and normalized to a concentration of 300 pg/ul for analysis on a High Sensitivity DNA Chip (Bioanalyzer, Agilent Technologies). Customer-provided data reproduced with permission.
Figure 2 | TeloPrime cDNA prepared with V2 PCR protocol from sheep total RNA (RIN 8.4). TeloPrime cDNA was generated from 1 µg of total RNA, with standard TeloPrime RT primer and amplified with the standard TeloPrime V2 PCR primers. For endpoint PCR, 1 µl of cDNA was amplified with 26 cycles. The PCR product was purified using TeloPrime purification solutions and columns, and analyzed on a DNA 12000 Chip (Bioanalyzer, Agilent Technologies). Customer-provided data reproduced with permission.
Figure 3 | TeloPrime cDNA generated with different PCR cycles. Endpoint PCR was performed using 2 µl of pooled TeloPrime cDNA with Optimal Endpoint PCR (OEP) cycle number (as calculated from qPCR, i.e., 80 % of maximum fluorescence), or using OEP ± 3 cycles. The amplified cDNA was analyzed on a Bioanalyzer DNA 12000 Chip (Agilent Technologies). Undercycling (green, OEP-3) produces low yields, while overcycling by 3 cycles (red, OEP +3) results in enrichment of shorter versus longer products and also reduces the yield. The optimal cycle number (blue, OEP) gives highest yield for longer cDNAs.

Performing a qPCR assay is recommended to determine the Optimal Endpoint PCR cycle number (OEP). This prevents under- or overcycling, which may have negative effects on downstream applications. Undercycling results in low yields and often insufficient material for downstream use, while overcycling will result in a loss of longer full-length cDNAs (Figure 4). Once the number of cycles for the endpoint PCR is established for a particular RNA sample type (including RNA quality level) and input amount, the same can be used for the following experiments without performing the qPCR each time. See also Appendix B (p.22) of the TeloPrime V2 User Guide.
Figure 4 | TeloPrime cDNA Quality Control. TeloPrime cDNA was prepared from 500 ng of Universal Human Reference RNA (UHRR). Amplification was performed using 1 µl of cDNA with 24 cycles of PCR. Final cDNA was run at 1:10 dilution on a Bioanalyzer High Sensitivity DNA Chip (Agilent Technologies). The optimal endpoint PCR (OEP) cycle number was determined by qPCR as described in Appendix B, p.22.

The TeloPrime Full-Length cDNA Amplification Kits (013) contain sufficient reagents to perform a qPCR and endpoint PCR for each sample. Lexogen also offers a TeloPrime PCR Add-on Kit (Cat.No. 018.16) for 16 reactions if additional PCRs are required.

The qPCR assay requires the addition of SYBR Green I dye to the PCR (final concentration of 0.1x in the reaction mix) and performing the amplification using a real-time PCR machine. Determine the cycle number at which the fluorescence reaches at 80% of the maximum. If using the same volume of cDNA for the endpoint PCR, this is the cycle number to be used for the endpoint PCR. If more cDNA is used for the endpoint PCR than for the qPCR, the cycle number may need to be adjusted. For example, if 2 µl of cDNA is used for the qPCR assay, and 9 µl will be used for endpoint PCR, subtract 2 cycles to account for using ~4x more cDNA as template for the final cDNA amplification. See Appendix B (p.22) of the TeloPrime V2 User Guide for more details.

The sequences of the PCR primers included in the TeloPrime Kit are outlined in Appendix D, p.25 of the TeloPrime V2 User Guide.

Yes! The Reverse Transcription, PCR Forward, and PCR Reverse Primers are added separately in the TeloPrime V2 protocol and can easily be exchanged. For details of custom prime use please see Appendix D (p.25) of the TeloPrime V2 User Guide.

The full-length cDNA products can be used for Next Generation Sequencing (NGS) library preparation for short (e.g. for Illumina instruments), or long-read sequencing applications (e.g. for Pacific Biosciences or Oxford Nanopore Technologies instruments), RACE, cloning, microarray probes, and normalization.

Any commercially available DNA-Seq library prep kit can be used following cDNA preparation and amplification using the TeloPrime V2 Kits, in order to produce ready-to-sequence libraries.

No, the TeloPrime V2 kits generate full-length double-stranded cDNA as a final product. The QuantSeq 3’ and SENSE kits are RNA-Seq library prep kits and can only use RNA as an input material.

TeloPrime can be used for long-read sequencing applications and is compatible with library preparation protocols for analysis on Pacific Biosciences and Oxford Nanopore Technologies platforms.
TeloPrime V2 and V1 libraries have been successfully sequenced on PacBio Sequel® instruments. For further details see our TeloPrime Publications page, or contact info@lexogen.com.
When TeloPrime cDNA is intended for Iso-Seq™ library preparation for sequencing on Sequel® instruments (Pacific Biosciences), additional adapters must be added to the ends of the cDNA to facilitate sequencing. For these applications we recommend the following:

• Use 1 – 2 µg of total RNA as input for TeloPrime cDNA generation.
• Use the highest possible quality of RNA
• Purify the amplified TeloPrime cDNA after the endpoint PCR using the Ampure PB® Beads from Pacific Biosciences (for further details see also Appendix D (p.26) of the TeloPrime V2 User Guide).
• TeloPrime V2 Iso-Seq libraries are best loaded for Sequel instruments using the diffusion loading method. Loading amounts around 6 pM have produced high outputs for TeloPrime V2 libraries. However, specific loading amounts may need to be adjusted according to the instrument and chemistry version in use.
• Contact Pacific Biosciences for further advice regarding the Iso-Seq™ protocols and sequencing recommendations.

TeloPrime libraries have been successfully sequenced on MinION devices and are featured in several recent publications.
To prepare TeloPrime cDNA for downstream sequencing on Oxford Nanopore Techologies instruments, adapter sequences must first be added to the ends of the cDNA. In general, Oxford Nanopore Technologies kits for DNA library preparation (omitting any DNA fragmentation steps), or PCR barcoding can be used. Contact Oxford Nanopore Technologies for specific advice on the right kit for your chosen application.

The full list of changes included in the Version 2 TeloPrime Full-Length cDNA Amplification and PCR Add-on Kits V2 can be found in the revision history of the TeloPrime V2 User Guide (Appendix E, p.27). Briefly, the enzyme and buffer for second strand synthesis and PCR, along with the respective protocol steps, were updated to provide improved yield and length distribution of amplified full-length TeloPrime cDNA. The following kit components were changed: Second Strand Mix (SS); Enzyme Mix 3 (E3); TeloPrime PCR Mix (Telo PCR), and DNA Buffer. The concentration of the PCR Forward and Reverse Primers (FP and RP) was also changed. Some of the reaction volumes, temperatures, and incubation times for steps 19 – 42 were also changed.
The method of cDNA generation using the proprietary Cap-Dependent Linker Ligation (CDLL) has not changed for the V2 protocol.

Use of the TeloPrime V2 PCR Add-on Kit is fully compatible for amplifying TeloPrime cDNA generated using the previous version 1 (V1) kits and vice versa, if necessary. However, we strongly recommend using only the V2 kits for endpoint PCR, as the new reaction conditions provide superior yields and length distribution.

TeloPrime V1 kits will remain available on an on-request basis until March 2019. If you wish to order TeloPrime V1 Kit please contact us at info@lexogen.com.

Sample barcoding can be included in two ways, either during reverse transcription through the use of custom reverse transcription primers (see Appendix D, p.25 of the TeloPrime V2 User Guide), or by adding sample barcodes after full-length cDNA amplification is complete. Sample multiplexing is supported for long-read sequencing platforms as well:

PacBio IsoSeq

Sample barcodes can be included in alternative oligodT-primers and used in place of the standard Reverse Transcription Primer (RTP) for the first strand cDNA synthesis (steps 1 – 3). We suggest to use the sample barcoded RT primer designs provided by PacBio for IsoSeq libraries (https://www.pacb.com/wp-content/uploads/2015/09/Procedure-Checklist-Multiplex-Isoform-Sequencing-Iso-Seq-Analysis.pdf). These primers can be ordered as desalted oligos. The concentration of these oligos in the reverse transcription reaction may need to be optimized within the range of: 12.5 nM – 1.5 uM.

In addition, a custom RP primer will be needed for the Endpoint PCR, to use together with the standard FP primer. This custom RP primer needs to bind the 5’ end of the barcoded RT primers and should have a melting temperature (Tm) matching, or as close as possible to that of the standard FP primer included in the TeloPrime V2 kit.

Oxford Nanopore

Sample barcodes can be introduced onto TeloPrime cDNA after endpoint PCR using the Oxford Nanopore PCR Barcoding Kit (SQK-PBK004). In order to have compatible adapters for the addition of ONT barcodes the RP and FP primers used for the TeloPrime V2 Endpoint PCR need to be modified to include ONT primer binding sequences.

Figure 5 | Schematic for addition of ONT adapters to TeloPrime cDNA for barcoding and ONT sequencing.

The alternative FP and RP primer sequences required are listed below. These can be ordered as desalted oligos and should be used for the Endpoint PCR at a final concentration of 2 uM.

FP-ONT: 5′– TTTCTGTTGGTGCTGATATTGC TGGATTGATATGTAATACGACTCACTATAG –3’

RP-ONT: 5′– ACTTGCCTGTCGCTCTATCTTC TCTCAGGCGTTTTTTTTTTTTTTTTTT — 3’

*bold sequence is the standard FP and RP sequence and the 5’ sequence is the ONT primer binding sequence.

The Endpoint PCR program should include one cycle at 50 degrees annealing temperature, then using 62 degrees annealing temperature for the remaining cycles.