Description

TeloPrime Full-Length cDNA Amplification Kit

The TeloPrime Full-Length cDNA Amplification Kit is an all-in-one protocol for generating full-length cDNA from total RNA.

Full-Length cDNA Synthesis

Based on Lexogen´s unique Cap-Dependent Linker Ligation (CDLL) and long reverse transcription (long RT) technology, it is highly selective for full-length RNA molecules that are both capped and polyadenylated.

For Multiple Downstream Applications

The full-length cDNA products can be used for various downstream applications such as NGS, RACE, cloning, microarray probes, and normalization. It enables the detection and correct quantification of splice variants and their true transcription start- and end-sites, in both short and long mRNA molecules. For further full-length or gene-specific PCRs, Lexogen offers a TeloPrime PCR Add-on Kit (Cat.No.018.30) containing 30 rxn. This kit contains the PCR Forward and Reverse Primer separately,hence they can be alternatively substituted with the gene-specific primer of interest.

Exceptional Elimination of cDNA from Degraded RNA

Based on the CDLL technology the ligation of the 5’ linker to the 3’ end of the cDNA takes place in a highly cap-dependent manner, providing an exceptional cap-specificity and eliminating cDNA products from degraded mRNA.
teloprimediagram

In an mRNA-Seq experiment, mRNAs were tagged at their 5’ end using TeloPrime, Template-Switch (TS) or Oligo Capping (OC). Transcript start sites (TSS) were mapped to the mouse genome. The accumulated TSS read coverage is plotted versus the normalized annotated transcript length to show relative TSS mapping for the top 500 expressed genes.

Workflow

The TeloPrime Full-Length cDNA Amplification Kit is a protocol for generating full-length cDNA from total RNA. It is based on Lexogen´s unique Cap-Dependent Linker Ligation (CDLL) and long reverse transcription (long RT) technology, and is highly selective for full-length RNA molecules that are both capped and polyadenylated.

First Strand cDNA Synthesis (Oligo dT Priming)
Step 1:
Firstly, full-length cDNA synthesis is initiated by oligodT primed long
reverse transcription. This helps to preserve the complete RNA sequence
information in the cDNA before a cap selection is carried out. In addition
a more stable RNA/cDNA hybrid is created that is maintained throughout
post RT purification. This double-stranded (ds) hybrid is also important for
the specificity of the subsequent Cap-Dependent Linker Ligation reaction.

Capped Poly(A) RNA

Degraded RNA

Double-Strand Specific Ligation
Step 2:
The double-stranded adapter with a 5’ C overhang allows for an atypical
base-pairing with the inverted G of the cap structure. By using a ds-specific
ligase, the ligation only takes place if the cap is present and if the RT has
really reached the 5’ end of the mRNA. No ligation takes place if no cap is
present e.g., in degraded RNA (low RIN) or if the RT has terminated prematurely
because of secondary structures.

Capped Poly(A) RNA

Degraded RNA

Second Strand Synthesis
Step 3:
Based on this Cap-Dependent Linker Ligation only products
with the 5’ tag get extended in the second-strand synthesis.

Capped Poly(A) RNA

Second Strand Synthesis
Step 4:
All remaining background is eliminated and the 5’ tagged
full-length cDNA is converted into full-length ds cDNA.

Capped Poly(A) RNA

Amplification of Full-length cDNA
Step 5:
Full-length cDNA is then globally amplified in a PCR reaction using 5’
and 3’ tag specific PCR primers to provide enough material for various
downstream applications.

For viewing the whole workflow on page please click here

Featured Publications

List of the most recent TeloPrime publications.

FAQ

Frequently Asked Questions

Please find a list of the most frequently asked questions below. If you cannot find the answer to your question here or want to know more about our products, please contact support@lexogen.com.

Open All

The full-length cDNA synthesis takes around 300 minutes in total, including just 60 minutes of hands-on time. For the full-length cDNA amplification using the qPCR and the endpoint PCRs another 300 minutes have to be considered, however only 25 minutes are hands-on time.
The protocol was extensively tested with input amounts of 1 ng to 2 µg of total RNA input using RNA extracted from mouse liver, kidney, brain, lung, spleen, thymus, and heart as well as Universal Human Reference RNA and Human Brain Reference RNA.Please consult Appendix A: RNA Requirements (page 18), TeloPrime User Guide for more details.
Performing a qPCR assay is recommended to determine the exact number of cycles for your endpoint PCR, thereby preventing under- or overcycling which could have negative effects on downstream applications. While you won´t have enough material when undercycling, overcycling will result in a loss of long full-length ds products. If the number of cycles for the endpoint PCR is once established for your specific RNA, it can be used for the following experiments as well without prior qPCR.
You can determine the cycle number of the endpoint PCR in a qPCR assay by addition of SYBR Green I (final concentration of 0.1x) to the mastermix and using 40 cycles to reach the plateau. Calculate where the fluorescence is at 80% of the maximum; this is the cycle number to be used for the endpoint PCR.Please consult Appendix B: Calculation of the Endpoint PCR (page 20), TeloPrime User Guide for more details.
The TeloPrime kit offers you enough reagents to perform one qPCR and one endpoint PCR for each sample. Lexogen also offers a TeloPrime PCR Add-on Kit (Cat.No. 018.30) with additional 30 reactions if you want to use the sample for more PCR reactions.
Tagging of the 3’ end of the mRNA takes place during the reverse transcription by oligodT priming of the total RNA.
Tagging on the 5’ end is based on Lexogen´s proprietary Cap Dependent Linker Ligation (CDLL) technology. After reverse transcription and the creation of a double-stranded RNA : cDNA hybrid an adapter with a 5’ C overhang allows for an atypical base-pairing with the inverted G of the cap structure. Hence, ligation is taking place using a double-strand specific ligase by ligating the 3’ end of the linker to the 3’ end of the cDNA.
The PCR primers included in the TeloPrime Kit have the following sequence.
FP: 5’ – TGGATTGATATGTAATACGACTCACTATAG – 3‘ RP: 5’ – TCTCAGGCGTTTTTTTTTTTTTTTTTT – 3‘
The FP contains the T7 promoter sequence.
The Reverse Transcription, PCR Forward, and PCR Reverse Primer are added separately in theTeloPrime protocol and can easily be exchanged. If exchanging the RT-primer to another oligodT or gene-specific primer just make sure to use the same sequence in the PCR amplification afterwards. Please keep in mind, the adapter sequences cannot be exchanged.
The full-length cDNA products can be used for Next Generation Sequencing (NGS) library preparation, RACE, cloning, microarray probes, and normalization.
Any commercially available DNA-Seq library prep kit can be used on top of the TeloPrime kit in order to produce sequence-ready libraries.
No, the TeloPrime kits generate full-length double-stranded DNA and the SENSE kits are RNA-Seq library prep kits and need RNA as an input material.

Downloads

TeloPrime Full-Length cDNA Amplification Kit

pdf  User Guide – update 01.04.2016 (consistency changes)
pdf  Product Flyer

Material Safety Datasheets

  MSDS information for TeloPrime Full-Length cDNA Amplification Kit

TeloPrime Free Trial Kit

Buy from our webstore

Dear Customer,

If you would like to receive a TeloPrime Free Trial Kit, please fill in the form.

If you have any questions, please do not hesitate to contact us at info@lexogen.com or +43 (0) 1 345 1212 – 41.

Your Name (required)

Your Email (required)

Institution (required)

Address (required)

Postcode, City (required)

Country (required)

Phone Number (required)

How have you learnt about Lexogen? (required)

Your Message

Type the characters:
captcha